1 genome

head ../data/Apulcra-genome.fa

>ntLink_7
TGTATTTCTAGAGATCTAAAGTACTCAGGATAGCTGAAAAAAAAACCGTC
GTTCTTTCCCTCTGAATTTCTCACTTAGGTTTTCTGGGATATGTGACGCG
CTGCAATCCTAAACAGCCACTAACGCCGGATGTCTTCAACCGAGCGCCTC
TGCTCGAAAGCTATCTGGACCATTTGAAGGTATGGTTCAGCTTGATTTAC
TGTTGCTTCGTAGTACTTTCATCCTGATGGTTCTAATGTGCTAAGTTTTC
GCACATATTCTAGGTCATTAGGTTCTAATAGCAATGAGCTTTCAGTGATT
CCCGAGAATACGCTTTCTGTAGCAGCAACTAAATTATGGAATGGTCTACC
CTAAAATCTTAGAAAGTCTACCTCGTATATCAGCAGGCTAACTGCTACGT
TCATTTTTCAAGCATTTGAAAGACGAAAGAAACAATAATAGTTAACCATA

library(seqinr)

# Replace 'input.fasta' with the name of your multi-sequence fasta file
input_file <- "../data/Apulcra-genome.fa"
sequences <- read.fasta(input_file)

# Set the seed for reproducibility (optional)
set.seed(42)

number_of_sequences_to_select <- 10

if (length(sequences) < number_of_sequences_to_select) {
  warning("There are fewer than 10 sequences in the fasta file. All sequences will be selected.")
  number_of_sequences_to_select <- length(sequences)
}

selected_indices <- sample(length(sequences), number_of_sequences_to_select)
selected_sequences <- sequences[selected_indices]

# Replace 'output.fasta' with your desired output file name
output_file <- "../output/28-Apul-CpG-Annotation/output.fasta"
write.fasta(selected_sequences, names(selected_sequences), output_file, open = "w")

#likely will not need; fix issue where gff and fa name did not match
# sed -i 's/>lcl|/>/g' ../output/10_seqs.fa

#needed downstream for IGV
/home/shared/samtools-1.12/samtools faidx \
../output/28-Apul-CpG-Annotation/output.fasta

fuzznuc -sequence ../output/28-Apul-CpG-Annotation/output.fasta -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff

tail ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff

2 Full run

fuzznuc -sequence ../data/Apulcra-genome.fa -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff

3 Intersectbed

bedtools intersect \
-a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \
-b ../data/Apulchra-genome.gff \
-wb \
> ../output/28-Apul-CpG-Annotation/intersect_both.gff

head ../output/28-Apul-CpG-Annotation/intersect_both.gff

tail -50 ../data/Apulchra-genome.gff

ptg000184l  funannotate exon    27291   27416   .   +   .   ID=FUN_044364-T1.exon2;Parent=FUN_044364-T1;
ptg000184l  funannotate exon    27559   27784   .   +   .   ID=FUN_044364-T1.exon3;Parent=FUN_044364-T1;
ptg000184l  funannotate exon    28179   28245   .   +   .   ID=FUN_044364-T1.exon4;Parent=FUN_044364-T1;
ptg000184l  funannotate exon    33400   35016   .   +   .   ID=FUN_044364-T1.exon5;Parent=FUN_044364-T1;
ptg000184l  funannotate CDS 26899   27163   .   +   0   ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l  funannotate CDS 27291   27416   .   +   2   ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l  funannotate CDS 27559   27784   .   +   2   ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l  funannotate CDS 28179   28245   .   +   1   ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l  funannotate CDS 33400   35016   .   +   0   ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000185l  funannotate gene    8952    9296    .   -   .   ID=FUN_044365;
ptg000185l  funannotate mRNA    8952    9296    .   -   .   ID=FUN_044365-T1;Parent=FUN_044365;product=hypothetical protein;
ptg000185l  funannotate exon    8952    9296    .   -   .   ID=FUN_044365-T1.exon1;Parent=FUN_044365-T1;
ptg000185l  funannotate CDS 8952    9296    .   -   0   ID=FUN_044365-T1.cds;Parent=FUN_044365-T1;
ptg000185l  funannotate gene    30137   34494   .   +   .   ID=FUN_044366;
ptg000185l  funannotate mRNA    30137   34494   .   +   .   ID=FUN_044366-T1;Parent=FUN_044366;product=hypothetical protein;
ptg000185l  funannotate exon    30137   30432   .   +   .   ID=FUN_044366-T1.exon1;Parent=FUN_044366-T1;
ptg000185l  funannotate exon    30536   30737   .   +   .   ID=FUN_044366-T1.exon2;Parent=FUN_044366-T1;
ptg000185l  funannotate exon    30865   31414   .   +   .   ID=FUN_044366-T1.exon3;Parent=FUN_044366-T1;
ptg000185l  funannotate exon    33568   34163   .   +   .   ID=FUN_044366-T1.exon4;Parent=FUN_044366-T1;
ptg000185l  funannotate exon    34251   34494   .   +   .   ID=FUN_044366-T1.exon5;Parent=FUN_044366-T1;
ptg000185l  funannotate CDS 30137   30432   .   +   0   ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l  funannotate CDS 30536   30737   .   +   1   ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l  funannotate CDS 30865   31414   .   +   0   ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l  funannotate CDS 33568   34163   .   +   2   ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l  funannotate CDS 34251   34494   .   +   0   ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000186l  funannotate gene    587 1375    .   +   .   ID=FUN_044367;
ptg000186l  funannotate mRNA    587 1375    .   +   .   ID=FUN_044367-T1;Parent=FUN_044367;product=hypothetical protein;
ptg000186l  funannotate exon    587 835 .   +   .   ID=FUN_044367-T1.exon1;Parent=FUN_044367-T1;
ptg000186l  funannotate exon    1070    1375    .   +   .   ID=FUN_044367-T1.exon2;Parent=FUN_044367-T1;
ptg000186l  funannotate CDS 587 835 .   +   0   ID=FUN_044367-T1.cds;Parent=FUN_044367-T1;
ptg000186l  funannotate CDS 1070    1375    .   +   0   ID=FUN_044367-T1.cds;Parent=FUN_044367-T1;
ptg000186l  funannotate gene    2304    2977    .   +   .   ID=FUN_044368;
ptg000186l  funannotate mRNA    2304    2977    .   +   .   ID=FUN_044368-T1;Parent=FUN_044368;product=hypothetical protein;
ptg000186l  funannotate exon    2304    2504    .   +   .   ID=FUN_044368-T1.exon1;Parent=FUN_044368-T1;
ptg000186l  funannotate exon    2576    2977    .   +   .   ID=FUN_044368-T1.exon2;Parent=FUN_044368-T1;
ptg000186l  funannotate CDS 2304    2504    .   +   0   ID=FUN_044368-T1.cds;Parent=FUN_044368-T1;
ptg000186l  funannotate CDS 2576    2977    .   +   0   ID=FUN_044368-T1.cds;Parent=FUN_044368-T1;
ptg000186l  funannotate gene    8523    11277   .   +   .   ID=FUN_044369;
ptg000186l  funannotate mRNA    8523    11277   .   +   .   ID=FUN_044369-T1;Parent=FUN_044369;product=hypothetical protein;
ptg000186l  funannotate exon    8523    8549    .   +   .   ID=FUN_044369-T1.exon1;Parent=FUN_044369-T1;
ptg000186l  funannotate exon    10894   11277   .   +   .   ID=FUN_044369-T1.exon2;Parent=FUN_044369-T1;
ptg000186l  funannotate CDS 8523    8549    .   +   0   ID=FUN_044369-T1.cds;Parent=FUN_044369-T1;
ptg000186l  funannotate CDS 10894   11277   .   +   0   ID=FUN_044369-T1.cds;Parent=FUN_044369-T1;
ptg000186l  funannotate gene    18980   19053   .   -   .   ID=FUN_044370;
ptg000186l  funannotate tRNA    18980   19053   .   -   .   ID=FUN_044370-T1;Parent=FUN_044370;product=tRNA-Thr;
ptg000186l  funannotate exon    18980   19053   .   -   .   ID=FUN_044370-T1.exon1;Parent=FUN_044370-T1;
ptg000187l  funannotate gene    16329   17045   .   -   .   ID=FUN_044371;
ptg000187l  funannotate mRNA    16329   17045   .   -   .   ID=FUN_044371-T1;Parent=FUN_044371;product=hypothetical protein;
ptg000187l  funannotate exon    16329   17045   .   -   .   ID=FUN_044371-T1.exon1;Parent=FUN_044371-T1;
ptg000187l  funannotate CDS 16329   17045   .   -   0   ID=FUN_044371-T1.cds;Parent=FUN_044371-T1;

awk -F'\t' '
BEGIN {
  header = "##gff-version 3"
}
$0 ~ /^#/ { next }
{
  outfile = "../output/28-Apul-CpG-Annotation/" $3 ".gff"
  if (!(outfile in written)) {
    print header > outfile
    written[outfile] = 1
  }
  print >> outfile
}' ../data/Apulchra-genome.gff

ls ../output/28-Apul-CpG-Annotation/*gff

../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff
../output/28-Apul-CpG-Annotation/CDS.gff
../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff
../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff
../output/28-Apul-CpG-Annotation/exon.gff
../output/28-Apul-CpG-Annotation/gene.gff
../output/28-Apul-CpG-Annotation/intersect_both.gff
../output/28-Apul-CpG-Annotation/mRNA.gff
../output/28-Apul-CpG-Annotation/tRNA.gff

bedtools intersect \
-a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \
-b ../output/28-Apul-CpG-Annotation/mRNA.gff \
-wb \
> ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff

head ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff

ntLink_7    fuzznuc nucleotide_motif    97  98  2   +   .   ID=ntLink_7.3;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    99  100 2   +   .   ID=ntLink_7.4;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    124 125 2   +   .   ID=ntLink_7.5;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    127 128 2   +   .   ID=ntLink_7.6;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    141 142 2   +   .   ID=ntLink_7.7;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    145 146 2   +   .   ID=ntLink_7.8;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    155 156 2   +   .   ID=ntLink_7.9;note=*pat pattern:CG  ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    209 210 2   +   .   ID=ntLink_7.10;note=*pat pattern:CG ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    250 251 2   +   .   ID=ntLink_7.11;note=*pat pattern:CG ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7    fuzznuc nucleotide_motif    303 304 2   +   .   ID=ntLink_7.12;note=*pat pattern:CG ntLink_7    funannotate mRNA    79  4679    .   +   .   ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;

--- title: "CpG Intersect" description: "Apul Motifs and matches" categories: [methylation, e5] #citation: date: 05-15-2025 image: http://gannet.fish.washington.edu/seashell/snaps/Monosnap_bestblogever_-_main_-_RStudio_2025-05-15_07-08-12.png # finding a good image author: - name: Steven Roberts url: orcid: 0000-0001-8302-1138 affiliation: Professor, UW - School of Aquatic and Fishery Sciences affiliation-url: https://robertslab.info #url: # self-defined draft: false # setting this to `true` will prevent your post from appearing on your listing page until you're ready! format: html: code-fold: FALSE code-tools: true code-copy: true highlight-style: github code-overflow: wrap --- - <a href="#1-genome" id="toc-1-genome">1 genome</a> - <a href="#2-full-run" id="toc-2-full-run">2 Full run</a> - <a href="#3-intersectbed" id="toc-3-intersectbed">3 Intersectbed</a> Annotating CpGs …. methylation calls derived at <https://sr320.github.io/tumbling-oysters/posts/37-Apul-meth/> Now there are files for each of the Apul samples @ <https://gannet.fish.washington.edu/seashell/bu-github/timeseries_molecular/D-Apul/output/15.5-Apul-bismark/> Maybe do all CpG in genome.. # 1 genome ``` bash head ../data/Apulcra-genome.fa ``` >ntLink_7 TGTATTTCTAGAGATCTAAAGTACTCAGGATAGCTGAAAAAAAAACCGTC GTTCTTTCCCTCTGAATTTCTCACTTAGGTTTTCTGGGATATGTGACGCG CTGCAATCCTAAACAGCCACTAACGCCGGATGTCTTCAACCGAGCGCCTC TGCTCGAAAGCTATCTGGACCATTTGAAGGTATGGTTCAGCTTGATTTAC TGTTGCTTCGTAGTACTTTCATCCTGATGGTTCTAATGTGCTAAGTTTTC GCACATATTCTAGGTCATTAGGTTCTAATAGCAATGAGCTTTCAGTGATT CCCGAGAATACGCTTTCTGTAGCAGCAACTAAATTATGGAATGGTCTACC CTAAAATCTTAGAAAGTCTACCTCGTATATCAGCAGGCTAACTGCTACGT TCATTTTTCAAGCATTTGAAAGACGAAAGAAACAATAATAGTTAACCATA ``` r library(seqinr) # Replace 'input.fasta' with the name of your multi-sequence fasta file input_file <- "../data/Apulcra-genome.fa" sequences <- read.fasta(input_file) ``` ``` r # Set the seed for reproducibility (optional) set.seed(42) number_of_sequences_to_select <- 10 if (length(sequences) < number_of_sequences_to_select) { warning("There are fewer than 10 sequences in the fasta file. All sequences will be selected.") number_of_sequences_to_select <- length(sequences) } selected_indices <- sample(length(sequences), number_of_sequences_to_select) selected_sequences <- sequences[selected_indices] ``` ``` r # Replace 'output.fasta' with your desired output file name output_file <- "../output/28-Apul-CpG-Annotation/output.fasta" write.fasta(selected_sequences, names(selected_sequences), output_file, open = "w") ``` ``` bash #likely will not need; fix issue where gff and fa name did not match # sed -i 's/>lcl|/>/g' ../output/10_seqs.fa ``` ``` bash #needed downstream for IGV /home/shared/samtools-1.12/samtools faidx \ ../output/28-Apul-CpG-Annotation/output.fasta ``` ``` bash fuzznuc -sequence ../output/28-Apul-CpG-Annotation/output.fasta -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff ``` ``` bash tail ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff ``` # 2 Full run ``` bash fuzznuc -sequence ../data/Apulcra-genome.fa -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff ``` # 3 Intersectbed ``` bash bedtools intersect \ -a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \ -b ../data/Apulchra-genome.gff \ -wb \ > ../output/28-Apul-CpG-Annotation/intersect_both.gff ``` ``` bash head ../output/28-Apul-CpG-Annotation/intersect_both.gff ``` ``` bash tail -50 ../data/Apulchra-genome.gff ``` ptg000184l funannotate exon 27291 27416 . + . ID=FUN_044364-T1.exon2;Parent=FUN_044364-T1; ptg000184l funannotate exon 27559 27784 . + . ID=FUN_044364-T1.exon3;Parent=FUN_044364-T1; ptg000184l funannotate exon 28179 28245 . + . ID=FUN_044364-T1.exon4;Parent=FUN_044364-T1; ptg000184l funannotate exon 33400 35016 . + . ID=FUN_044364-T1.exon5;Parent=FUN_044364-T1; ptg000184l funannotate CDS 26899 27163 . + 0 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1; ptg000184l funannotate CDS 27291 27416 . + 2 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1; ptg000184l funannotate CDS 27559 27784 . + 2 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1; ptg000184l funannotate CDS 28179 28245 . + 1 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1; ptg000184l funannotate CDS 33400 35016 . + 0 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1; ptg000185l funannotate gene 8952 9296 . - . ID=FUN_044365; ptg000185l funannotate mRNA 8952 9296 . - . ID=FUN_044365-T1;Parent=FUN_044365;product=hypothetical protein; ptg000185l funannotate exon 8952 9296 . - . ID=FUN_044365-T1.exon1;Parent=FUN_044365-T1; ptg000185l funannotate CDS 8952 9296 . - 0 ID=FUN_044365-T1.cds;Parent=FUN_044365-T1; ptg000185l funannotate gene 30137 34494 . + . ID=FUN_044366; ptg000185l funannotate mRNA 30137 34494 . + . ID=FUN_044366-T1;Parent=FUN_044366;product=hypothetical protein; ptg000185l funannotate exon 30137 30432 . + . ID=FUN_044366-T1.exon1;Parent=FUN_044366-T1; ptg000185l funannotate exon 30536 30737 . + . ID=FUN_044366-T1.exon2;Parent=FUN_044366-T1; ptg000185l funannotate exon 30865 31414 . + . ID=FUN_044366-T1.exon3;Parent=FUN_044366-T1; ptg000185l funannotate exon 33568 34163 . + . ID=FUN_044366-T1.exon4;Parent=FUN_044366-T1; ptg000185l funannotate exon 34251 34494 . + . ID=FUN_044366-T1.exon5;Parent=FUN_044366-T1; ptg000185l funannotate CDS 30137 30432 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1; ptg000185l funannotate CDS 30536 30737 . + 1 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1; ptg000185l funannotate CDS 30865 31414 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1; ptg000185l funannotate CDS 33568 34163 . + 2 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1; ptg000185l funannotate CDS 34251 34494 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1; ptg000186l funannotate gene 587 1375 . + . ID=FUN_044367; ptg000186l funannotate mRNA 587 1375 . + . ID=FUN_044367-T1;Parent=FUN_044367;product=hypothetical protein; ptg000186l funannotate exon 587 835 . + . ID=FUN_044367-T1.exon1;Parent=FUN_044367-T1; ptg000186l funannotate exon 1070 1375 . + . ID=FUN_044367-T1.exon2;Parent=FUN_044367-T1; ptg000186l funannotate CDS 587 835 . + 0 ID=FUN_044367-T1.cds;Parent=FUN_044367-T1; ptg000186l funannotate CDS 1070 1375 . + 0 ID=FUN_044367-T1.cds;Parent=FUN_044367-T1; ptg000186l funannotate gene 2304 2977 . + . ID=FUN_044368; ptg000186l funannotate mRNA 2304 2977 . + . ID=FUN_044368-T1;Parent=FUN_044368;product=hypothetical protein; ptg000186l funannotate exon 2304 2504 . + . ID=FUN_044368-T1.exon1;Parent=FUN_044368-T1; ptg000186l funannotate exon 2576 2977 . + . ID=FUN_044368-T1.exon2;Parent=FUN_044368-T1; ptg000186l funannotate CDS 2304 2504 . + 0 ID=FUN_044368-T1.cds;Parent=FUN_044368-T1; ptg000186l funannotate CDS 2576 2977 . + 0 ID=FUN_044368-T1.cds;Parent=FUN_044368-T1; ptg000186l funannotate gene 8523 11277 . + . ID=FUN_044369; ptg000186l funannotate mRNA 8523 11277 . + . ID=FUN_044369-T1;Parent=FUN_044369;product=hypothetical protein; ptg000186l funannotate exon 8523 8549 . + . ID=FUN_044369-T1.exon1;Parent=FUN_044369-T1; ptg000186l funannotate exon 10894 11277 . + . ID=FUN_044369-T1.exon2;Parent=FUN_044369-T1; ptg000186l funannotate CDS 8523 8549 . + 0 ID=FUN_044369-T1.cds;Parent=FUN_044369-T1; ptg000186l funannotate CDS 10894 11277 . + 0 ID=FUN_044369-T1.cds;Parent=FUN_044369-T1; ptg000186l funannotate gene 18980 19053 . - . ID=FUN_044370; ptg000186l funannotate tRNA 18980 19053 . - . ID=FUN_044370-T1;Parent=FUN_044370;product=tRNA-Thr; ptg000186l funannotate exon 18980 19053 . - . ID=FUN_044370-T1.exon1;Parent=FUN_044370-T1; ptg000187l funannotate gene 16329 17045 . - . ID=FUN_044371; ptg000187l funannotate mRNA 16329 17045 . - . ID=FUN_044371-T1;Parent=FUN_044371;product=hypothetical protein; ptg000187l funannotate exon 16329 17045 . - . ID=FUN_044371-T1.exon1;Parent=FUN_044371-T1; ptg000187l funannotate CDS 16329 17045 . - 0 ID=FUN_044371-T1.cds;Parent=FUN_044371-T1; ``` bash awk -F'\t' ' BEGIN { header = "##gff-version 3" } $0 ~ /^#/ { next } { outfile = "../output/28-Apul-CpG-Annotation/" $3 ".gff" if (!(outfile in written)) { print header > outfile written[outfile] = 1 } print >> outfile }' ../data/Apulchra-genome.gff ``` ``` bash ls ../output/28-Apul-CpG-Annotation/*gff ``` ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff ../output/28-Apul-CpG-Annotation/CDS.gff ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff ../output/28-Apul-CpG-Annotation/exon.gff ../output/28-Apul-CpG-Annotation/gene.gff ../output/28-Apul-CpG-Annotation/intersect_both.gff ../output/28-Apul-CpG-Annotation/mRNA.gff ../output/28-Apul-CpG-Annotation/tRNA.gff ``` bash bedtools intersect \ -a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \ -b ../output/28-Apul-CpG-Annotation/mRNA.gff \ -wb \ > ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff ``` ``` bash head ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff ``` ntLink_7 fuzznuc nucleotide_motif 97 98 2 + . ID=ntLink_7.3;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 99 100 2 + . ID=ntLink_7.4;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 124 125 2 + . ID=ntLink_7.5;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 127 128 2 + . ID=ntLink_7.6;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 141 142 2 + . ID=ntLink_7.7;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 145 146 2 + . ID=ntLink_7.8;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 155 156 2 + . ID=ntLink_7.9;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 209 210 2 + . ID=ntLink_7.10;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 250 251 2 + . ID=ntLink_7.11;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein; ntLink_7 fuzznuc nucleotide_motif 303 304 2 + . ID=ntLink_7.12;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;