Annotating CpGs ….
methylation calls derived at https://sr320.github.io/tumbling-oysters/posts/37-Apul-meth/
Now there are files for each of the Apul samples
Maybe do all CpG in genome..
1 genome
head ../data/Apulcra-genome.fa>ntLink_7
TGTATTTCTAGAGATCTAAAGTACTCAGGATAGCTGAAAAAAAAACCGTC
GTTCTTTCCCTCTGAATTTCTCACTTAGGTTTTCTGGGATATGTGACGCG
CTGCAATCCTAAACAGCCACTAACGCCGGATGTCTTCAACCGAGCGCCTC
TGCTCGAAAGCTATCTGGACCATTTGAAGGTATGGTTCAGCTTGATTTAC
TGTTGCTTCGTAGTACTTTCATCCTGATGGTTCTAATGTGCTAAGTTTTC
GCACATATTCTAGGTCATTAGGTTCTAATAGCAATGAGCTTTCAGTGATT
CCCGAGAATACGCTTTCTGTAGCAGCAACTAAATTATGGAATGGTCTACC
CTAAAATCTTAGAAAGTCTACCTCGTATATCAGCAGGCTAACTGCTACGT
TCATTTTTCAAGCATTTGAAAGACGAAAGAAACAATAATAGTTAACCATA
library(seqinr)
# Replace 'input.fasta' with the name of your multi-sequence fasta file
input_file <- "../data/Apulcra-genome.fa"
sequences <- read.fasta(input_file)# Set the seed for reproducibility (optional)
set.seed(42)
number_of_sequences_to_select <- 10
if (length(sequences) < number_of_sequences_to_select) {
warning("There are fewer than 10 sequences in the fasta file. All sequences will be selected.")
number_of_sequences_to_select <- length(sequences)
}
selected_indices <- sample(length(sequences), number_of_sequences_to_select)
selected_sequences <- sequences[selected_indices]# Replace 'output.fasta' with your desired output file name
output_file <- "../output/28-Apul-CpG-Annotation/output.fasta"
write.fasta(selected_sequences, names(selected_sequences), output_file, open = "w")#likely will not need; fix issue where gff and fa name did not match
# sed -i 's/>lcl|/>/g' ../output/10_seqs.fa#needed downstream for IGV
/home/shared/samtools-1.12/samtools faidx \
../output/28-Apul-CpG-Annotation/output.fastafuzznuc -sequence ../output/28-Apul-CpG-Annotation/output.fasta -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gfftail ../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff2 Full run
fuzznuc -sequence ../data/Apulcra-genome.fa -pattern CG -rformat gff -outfile ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff3 Intersectbed
bedtools intersect \
-a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \
-b ../data/Apulchra-genome.gff \
-wb \
> ../output/28-Apul-CpG-Annotation/intersect_both.gffhead ../output/28-Apul-CpG-Annotation/intersect_both.gfftail -50 ../data/Apulchra-genome.gffptg000184l funannotate exon 27291 27416 . + . ID=FUN_044364-T1.exon2;Parent=FUN_044364-T1;
ptg000184l funannotate exon 27559 27784 . + . ID=FUN_044364-T1.exon3;Parent=FUN_044364-T1;
ptg000184l funannotate exon 28179 28245 . + . ID=FUN_044364-T1.exon4;Parent=FUN_044364-T1;
ptg000184l funannotate exon 33400 35016 . + . ID=FUN_044364-T1.exon5;Parent=FUN_044364-T1;
ptg000184l funannotate CDS 26899 27163 . + 0 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l funannotate CDS 27291 27416 . + 2 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l funannotate CDS 27559 27784 . + 2 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l funannotate CDS 28179 28245 . + 1 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000184l funannotate CDS 33400 35016 . + 0 ID=FUN_044364-T1.cds;Parent=FUN_044364-T1;
ptg000185l funannotate gene 8952 9296 . - . ID=FUN_044365;
ptg000185l funannotate mRNA 8952 9296 . - . ID=FUN_044365-T1;Parent=FUN_044365;product=hypothetical protein;
ptg000185l funannotate exon 8952 9296 . - . ID=FUN_044365-T1.exon1;Parent=FUN_044365-T1;
ptg000185l funannotate CDS 8952 9296 . - 0 ID=FUN_044365-T1.cds;Parent=FUN_044365-T1;
ptg000185l funannotate gene 30137 34494 . + . ID=FUN_044366;
ptg000185l funannotate mRNA 30137 34494 . + . ID=FUN_044366-T1;Parent=FUN_044366;product=hypothetical protein;
ptg000185l funannotate exon 30137 30432 . + . ID=FUN_044366-T1.exon1;Parent=FUN_044366-T1;
ptg000185l funannotate exon 30536 30737 . + . ID=FUN_044366-T1.exon2;Parent=FUN_044366-T1;
ptg000185l funannotate exon 30865 31414 . + . ID=FUN_044366-T1.exon3;Parent=FUN_044366-T1;
ptg000185l funannotate exon 33568 34163 . + . ID=FUN_044366-T1.exon4;Parent=FUN_044366-T1;
ptg000185l funannotate exon 34251 34494 . + . ID=FUN_044366-T1.exon5;Parent=FUN_044366-T1;
ptg000185l funannotate CDS 30137 30432 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l funannotate CDS 30536 30737 . + 1 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l funannotate CDS 30865 31414 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l funannotate CDS 33568 34163 . + 2 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000185l funannotate CDS 34251 34494 . + 0 ID=FUN_044366-T1.cds;Parent=FUN_044366-T1;
ptg000186l funannotate gene 587 1375 . + . ID=FUN_044367;
ptg000186l funannotate mRNA 587 1375 . + . ID=FUN_044367-T1;Parent=FUN_044367;product=hypothetical protein;
ptg000186l funannotate exon 587 835 . + . ID=FUN_044367-T1.exon1;Parent=FUN_044367-T1;
ptg000186l funannotate exon 1070 1375 . + . ID=FUN_044367-T1.exon2;Parent=FUN_044367-T1;
ptg000186l funannotate CDS 587 835 . + 0 ID=FUN_044367-T1.cds;Parent=FUN_044367-T1;
ptg000186l funannotate CDS 1070 1375 . + 0 ID=FUN_044367-T1.cds;Parent=FUN_044367-T1;
ptg000186l funannotate gene 2304 2977 . + . ID=FUN_044368;
ptg000186l funannotate mRNA 2304 2977 . + . ID=FUN_044368-T1;Parent=FUN_044368;product=hypothetical protein;
ptg000186l funannotate exon 2304 2504 . + . ID=FUN_044368-T1.exon1;Parent=FUN_044368-T1;
ptg000186l funannotate exon 2576 2977 . + . ID=FUN_044368-T1.exon2;Parent=FUN_044368-T1;
ptg000186l funannotate CDS 2304 2504 . + 0 ID=FUN_044368-T1.cds;Parent=FUN_044368-T1;
ptg000186l funannotate CDS 2576 2977 . + 0 ID=FUN_044368-T1.cds;Parent=FUN_044368-T1;
ptg000186l funannotate gene 8523 11277 . + . ID=FUN_044369;
ptg000186l funannotate mRNA 8523 11277 . + . ID=FUN_044369-T1;Parent=FUN_044369;product=hypothetical protein;
ptg000186l funannotate exon 8523 8549 . + . ID=FUN_044369-T1.exon1;Parent=FUN_044369-T1;
ptg000186l funannotate exon 10894 11277 . + . ID=FUN_044369-T1.exon2;Parent=FUN_044369-T1;
ptg000186l funannotate CDS 8523 8549 . + 0 ID=FUN_044369-T1.cds;Parent=FUN_044369-T1;
ptg000186l funannotate CDS 10894 11277 . + 0 ID=FUN_044369-T1.cds;Parent=FUN_044369-T1;
ptg000186l funannotate gene 18980 19053 . - . ID=FUN_044370;
ptg000186l funannotate tRNA 18980 19053 . - . ID=FUN_044370-T1;Parent=FUN_044370;product=tRNA-Thr;
ptg000186l funannotate exon 18980 19053 . - . ID=FUN_044370-T1.exon1;Parent=FUN_044370-T1;
ptg000187l funannotate gene 16329 17045 . - . ID=FUN_044371;
ptg000187l funannotate mRNA 16329 17045 . - . ID=FUN_044371-T1;Parent=FUN_044371;product=hypothetical protein;
ptg000187l funannotate exon 16329 17045 . - . ID=FUN_044371-T1.exon1;Parent=FUN_044371-T1;
ptg000187l funannotate CDS 16329 17045 . - 0 ID=FUN_044371-T1.cds;Parent=FUN_044371-T1;
awk -F'\t' '
BEGIN {
header = "##gff-version 3"
}
$0 ~ /^#/ { next }
{
outfile = "../output/28-Apul-CpG-Annotation/" $3 ".gff"
if (!(outfile in written)) {
print header > outfile
written[outfile] = 1
}
print >> outfile
}' ../data/Apulchra-genome.gffls ../output/28-Apul-CpG-Annotation/*gff../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff
../output/28-Apul-CpG-Annotation/CDS.gff
../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gff
../output/28-Apul-CpG-Annotation/CGoutput-10seq.gff
../output/28-Apul-CpG-Annotation/exon.gff
../output/28-Apul-CpG-Annotation/gene.gff
../output/28-Apul-CpG-Annotation/intersect_both.gff
../output/28-Apul-CpG-Annotation/mRNA.gff
../output/28-Apul-CpG-Annotation/tRNA.gff
bedtools intersect \
-a ../output/28-Apul-CpG-Annotation/Apul-CG-motifs.gff \
-b ../output/28-Apul-CpG-Annotation/mRNA.gff \
-wb \
> ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gffhead ../output/28-Apul-CpG-Annotation/CG_intersect_mRNA.gffntLink_7 fuzznuc nucleotide_motif 97 98 2 + . ID=ntLink_7.3;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 99 100 2 + . ID=ntLink_7.4;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 124 125 2 + . ID=ntLink_7.5;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 127 128 2 + . ID=ntLink_7.6;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 141 142 2 + . ID=ntLink_7.7;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 145 146 2 + . ID=ntLink_7.8;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 155 156 2 + . ID=ntLink_7.9;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 209 210 2 + . ID=ntLink_7.10;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 250 251 2 + . ID=ntLink_7.11;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;
ntLink_7 fuzznuc nucleotide_motif 303 304 2 + . ID=ntLink_7.12;note=*pat pattern:CG ntLink_7 funannotate mRNA 79 4679 . + . ID=FUN_002303-T1;Parent=FUN_002303;product=hypothetical protein;